npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2026 – Pkg Stats / Ryan Hefner

@fishka/seqalgo

v1.1.0

Published

Sequence algorithms for bioinformatics — pairwise alignment (Needleman-Wunsch / EMBOSS-compatible) and related sequence analysis utilities

Readme

@fishka/seqalgo

Bioinformatics algorithms over biological sequences. The algorithmic companion to @fishka/seqio: seqio reads and writes sequence file formats, seqalgo analyses the sequences.

Currently supports:

  • Needleman-Wunsch global alignment — pairwise DNA alignment with the EDNAFULL (NUC4.4) scoring matrix and full IUPAC ambiguity-code support. Scores are 100% compatible with EMBOSS needle.

Planned: alignment post-processing utilities, mutation classification, consensus calling, heteroplasmy detection.

Install

npm install @fishka/seqalgo

Use

import { needleAlign } from '@fishka/seqalgo';
// or: import { needleAlign } from '@fishka/seqalgo/needle';

const result = needleAlign('GATCACAGGT', 'GATCAGGT');
result.seqA; // aligned reference: "GATCACAGGT"
result.seqB; // aligned read:      "GAT--CAGGT"
result.score; // EMBOSS-equivalent alignment score: 29.5

Options

needleAlign(ref, read, {
  gapOpen: 10, // EMBOSS gapopen, default 10
  gapExtend: 0.5, // EMBOSS gapextend, default 0.5
  gapAnchor: '5-prime', // indel placement in equally-scoring tracts, default '5-prime'
});

Indel anchoring (gapAnchor)

Alignment scores are always identical to EMBOSS needle. The option only affects where indels land within homopolymer/repeat tracts, where several alignments score equally:

  • '5-prime' (default) — gaps are left-anchored, matching the EMBOSS needle default tie-break.
  • '3-prime' — gaps are right-anchored, per the ISFG forensic mtDNA notation convention (Parson et al. 2014, §3.2). An extra C in the rCRS HV2 poly-C tract 303-309 is then reported at the 3' end of the run (309.1C) rather than the 5' end (302.1C).
// rCRS HV2 fragment with an extra C in the 7-C tract (303-309) — same score,
// different placement. The tract must be flanked on both sides for the anchoring
// to matter; with unflanked synthetic strings a free end-gap masks the tie-break.
const ref = 'AATTTCCACCAAACCCCCCCTCCCCCGCTTCTGGCCACAG';
const read = 'AATTTCCACCAAACCCCCCCCTCCCCCGCTTCTGGCCACAG';

needleAlign(ref, read).seqA;
// → "AATTTCCACCAAA-CCCCCCCTCCCCCGCTTCTGGCCACAG"  (5'-anchored, default)

needleAlign(ref, read, { gapAnchor: '3-prime' }).seqA;
// → "AATTTCCACCAAACCCCCCC-TCCCCCGCTTCTGGCCACAG"  (3'-anchored, ISFG mtDNA convention)

License

Apache-2.0