npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2026 – Pkg Stats / Ryan Hefner

@lipme/omique-utils-pipeline

v0.1.14

Published

A utility pipeline for visualizing and analyzing genomic data, designed for bioinformatics applications.

Downloads

115

Readme

Omique Utils Pipeline

A utility pipeline for transforming genomic data, designed for bioinformatics applications.

Table of Contents


Installation

To install the package, use npm:

npm install @lipme/omique-utils-pipeline

Usage

This library provides utilities for working with genomic data, including BAM and GFF3 file processing.

Examples

1. Setting BAM Levels

import { setBamsLevels } from "@lipme/omique-utils-pipeline";

const bams = [
  { start: 1, end: 3 },
  { start: 2, end: 4 },
  { start: 3, end: 5 },
];

const leveledBams = setBamsLevels(bams);
console.log(leveledBams);

2. Extracting CIGAR Information

import { cigarExtraction } from "@lipme/omique-utils-pipeline";

const bamData = [{ start: 1, end: 100, cigar: "10M5I5D" }];

const extractedCigar = cigarExtraction(bamData);
console.log(extractedCigar);

3. Parsing MD Tags

import { extractMD } from "@lipme/omique-utils-pipeline";

const bamLines = [
  {
    MD: "10A5^C3",
    seq: "ACGTACGTACGTACGTACGT",
    start: 1,
    end: 20,
    strand: "+",
  },
];

const mdData = extractMD(bamLines);
console.log(mdData);

4. Assigning GFF Levels

import { RowNumberFactory } from "@lipme/omique-utils-pipeline";

const features = [
  { start: 1, end: 100 },
  { start: 50, end: 150 },
];

const rowFactory = RowNumberFactory(features);
const leveledFeatures = features.map(rowFactory);
console.log(leveledFeatures);

Running Tests

To run the test suite, use:

npm test

For test coverage:

npm run test:coverage

To watch tests during development:

npm run test:watch

Building Locally

To build the project locally:

  1. Clone the repository:

    git clone https://github.com/your-repo/omique-utils-pipeline.git
    cd omique-utils-pipeline
  2. Install dependencies:

    npm install
  3. Build the project:

    npm run build

The output will be available in the dist directory.


Contributing

Contributions are welcome! Please follow these steps:

  1. Fork the repository.
  2. Create a new branch for your feature or bugfix.
  3. Commit your changes and push the branch.
  4. Open a pull request.

License

This project is licensed under the ISC License. See the LICENSE file for details.