npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2026 – Pkg Stats / Ryan Hefner

@mmsb/result_page

v3.4.0

Published

Stencil Component Starter

Downloads

368

Readme

Built With Stencil

Table of sgRNA with radial representation

example display

Usage

Need property to launch integrated components. So need complete_data to create the table-crispr component to the left side and alL_data, org_names and potentially gene to create genomic-card component.

If the gene property is given, then the linear-card component is created when the user click on a sector on the sunburst.

complete_data

A list of dictionary object in JSON format. Each dictionary has two keys : sequence and occurences. Occurences contains a list of dictionary object with org and all_ref as keys. all_ref contains a list of dictionary object with ref and coords keys which contains a list of coordinates. Coordinate must match the regex : [+-]\([0-9]*,[0-9]*\)

[
    {
        "sequence": "AAAACTCAAATGAATTGACGGGG",
        "occurences": [
            {
                "org": "Buchnera aphidicola (Cinara tujafilina) GCF_000217635.1",
                "all_ref": [
                    {
                        "ref": "NC_015662.1",
                        "coords": [
                            "-(195725,195747)"
                        ]
                    }
                ]
            },
            {
                "org": "Aliivibrio wodanis GCF_000953695.1",
                "all_ref": [
                    {
                        "ref": "NZ_LN554846.1",
                        "coords": [
                            "+(2675080,2675102)",
                            "+(2862314,2862336)",
                            "+(2959996,2960018)",
                            "-(507284,507306)",
                            "-(559657,559679)",
                            "-(661047,661069)"
                        ]
                    },
                    {
                        "ref": "NZ_LN554847.1",
                        "coords": [
                            "+(894485,894507)"
                        ]
                    }
                ]
            }
        ]
    }
]

all_data

A dictionary of organisms selected in JSON format with their referencesn sgRNA on them and their coordinates which must match the regex : [+-]\([0-9]*,[0-9]*\)

{
  "Buchnera aphidicola (Cinara tujafilina) GCF_000217635.1":
  {"NC_015662.1":
    {"AAAACTCAAATGAATTGACGGGG":
      ["-(195725,195747)"],
    "AAACTCAAATGAATTGACGGGGG":
      ["-(195726,195748)"],
    "TCCCCACTGCTGCCTCCCGTAGG":
      ["+(506719,506741)", "+(559092,559114)", "+(660482,660504)", "-(2675645,2675667)", "-(2862879,2862901)", "-(2960561,2960583)"]
    }
  },
  "Aliivibrio wodanis GCF_000953695.1":
    {"NZ_LN554846.1":
      {"AAAACTCAAATGAATTGACGGGG":
        ["+(2675080,2675102)", "+(2862314,2862336)", "+(2959996,2960018)", "-(507284,507306)", "-(559657,559679)", "-(661047,661069)"]
      },
    "NZ_LN554847.1":
      {"AAAACTCAAATGAATTGACGGGG":
        ["+(894485,894507)"]
      }
    }
}

org_names

A string of organisms names selected seperated by "&".

"Enterobacter sp. 638 GCF_000016325.1&Candidatus Blochmannia vafer str. BVAF GCF_000185985.2"

size

If no precise, all size are set to 4,518,734.

{
  "Enterobacter sp. 638 GCF_000016325.1":
    {"NC_009436.1":100000},
  "Candidatus Blochmannia vafer str. BVAF GCF_000185985.2":
    {"NC_014909.2": 2000000}}

gene

A dictionary object with organisms as keys and their references. Then, a list of dictionary with start and end keys to indicate coordinates of gene.

{
  "Enterobacter sp. 638 GCF_000016325.1":
    {"NC_009436.1":
      [{"start": "255180", "end": "255599"}, {"start": "842680", "end": "843099"}, {"start": "3343077", "end": "3343496"}, {"start": "4024310", "end": "4024729"}, {"start": "4269724", "end": "4270143"}, {"start": "4360796", "end": "4361215"}, {"start": "4466539", "end": "4466958"}]
    },
  "Candidatus Blochmannia vafer str. BVAF GCF_000185985.2":
    {"NC_014909.2":
      [{"start": "626246", "end": "626664"}]
    }
}

Event

***** GENOMIC-CARD *****

Emit

  • changeOrgCard : sent the name of the organism selected

  • changeRefCard : sent the reference selected

  • changeSgrnaCard : sent the sgRNA selected

  • sgDataSection : sent : allSgrna --> dictionary of sgRNA with their coordinates in a list gene --> a list of dictionary containing start and stop for genes

Send

  • changeOrgCard : change the organism selected, find data associated to this organism and create a new representation

  • changeRefCard : change the reference selected, find data associated and create a new representation

  • changeSgrnaCard : represent sgRNA selected by a red vertical line around the circle

  • changeOrgRefSgrna : find name of the organism name and its reference in axis key and sgRNA selected in sgrna key. Find data associated and create a new representation

Authors

Sophie LEMATRE

Date

July 22 2019