@phantomas1234/seqviz
v3.3.10
Published
DNA sequence viewer. Supports custom, GenBank, FASTA, or NCBI accession input
Downloads
77
Maintainers
Readme
SeqViz
SeqViz is a sequence viewer. It supports multiple input formats, display settings, and callbacks for integration into any JavaScript app.
Features
Multiple input formats
- Raw sequence and annotations
- File (FASTA, GenBank, SBOL, SnapGene)
- Accession (NCBI or iGEM)
Linear and/or Circular sequence viewer
- Display as a linear viewer, circular viewer, or both
- Annotations with names and colors
- Amino acid translations
- Enzyme cut sites
- Sequence basepair indexing
- Sequence searching and highlighting
Sequence and element selection
- Selecting a sequence range -- or clicking an
annotation,translation,enzymeorsearchElement-- will highlight that section of the viewer(s) and pass the selection to theonSelection()callback
Usage
Installation
npm
npm install seqvizCDN
<script src="https://unpkg.com/seqviz"></script>Instantiation
React
import { SeqViz } from "seqviz";
export default () => (
<SeqViz
name="J23100"
seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC"
annotations={[{ name: "promoter", start: 0, end: 34, direction: 1, color: "blue" }]}
/>
);Non-React
More details are in the Viewer without React section.
<script>
window.seqviz
.Viewer("root", {
name: "L09136",
seq: "tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgca",
style: { height: "100vh", width: "100vw" },
})
.render();
</script>Props
All the following are usable as props for the React component (seqviz.SeqViz) or as options for the plain JS implementation (seqviz.Viewer()).
Required (one of)
seq (='')
The DNA sequence to render.
accession (='')
An NCBI accession ID or iGEM part ID. Populates name, seq, and annotations.
file (=null)
A File, Blob, or body (string/utf8) from a FASTA, Genbank, SnapGene, or SBOL file. Populates name, seq, and annotations.
Optional
viewer (='both')
One of "linear" | "circular" | "both" | "both_flip". The type and orientation of the sequence viewers. both means the circular viewer fills the left side of SeqViz and the linear viewer fills the right. both_flip is the opposite: the linear viewer is on the left and the circular viewer is on the right.
name (='')
The name of the sequence/plasmid.
compSeq (='')
The complement sequence. Inferred from seq by default.
showComplement (=true)
Whether to show the complement sequence.
showIndex (=true)
Whether to show the index line and ticks below the sequence.
annotations (=[])
An array of annotation objects for the viewer. Each annotation requires 0-based start (inclusive) and end
(exclusive) indexes. For forward arrows, set the annotation's direction to 1 and -1 for reverse arrows. A direction
of 0 or no direction produces annotations without arrows. Names (optional) are rendered on top the annotation.
[
{ start: 0, end: 22, name: "Strong promoter", direction: 1 }, // [0, 22)
{ start: 23, end: 273, name: "GFP" },
{ start: 300, end: 325, name: "Weak promoter", direction: -1, color: "#FAA887" },
];In the example above, the "Strong promoter" would span the first to twenty-second basepair.
translations (=[])
An array of translation objects for rendering ranges of amino acids beneath the DNA sequence. Like annotation's,
translation objects requires 0-based start (inclusive) and end (exclusive) indexes relative the DNA sequence. A
direction is required: 1 (FWD) or -1 (REV).
[
{ start: 0, end: 90, direction: 1 }, // [0, 90)
{ start: 191, end: 522, direction: -1 },
];enzymes (=[])
An array of restriction enzyme names whose recognition sites should be shown. Example: ["PstI", "EcoRI"]. This is
case-insensitive. The list of supported enzymes is in src/utils/enzymes.js.
enzymesCustom (={})
Unsupported enzymes can also be passed through an object where the keys are the enzymes' names and the values are the enzymes. Additionally, if a highlightColor is passed the recognition site will be highlighted with the appropriate color.
{
Cas9: {
rseq: "NGG", // recognition sequence
fcut: 0, // cut index on FWD strand, relative to start of rseq
rcut: 1, // cut index on REV strand, relative to start of rseq
highlightColor: "#D7E5F0" // highlight recognition site with color
}
}zoom (={ linear: 50, circular: 0 })
How zoomed the viewer(s) should be 0-100. Keyed by viewer type (viewer).
colors (=[])
An array of colors to use for annotations, translations, and highlights. Defaults to:
[
"#9DEAED", // cyan
"#8FDE8C", // green
"#CFF283", // light green
"#8CDEBD", // teal
"#F0A3CE", // pink
"#F7C672", // orange
"#F07F7F", // red
"#FAA887", // red-orange
"#F099F7", // magenta
"#C59CFF", // purple
"#6B81FF", // blue
"#85A6FF", // light blue
];bpColors (={})
An object that maps basepairs to their color. The key/bp is either a nucleotide type or 0-based index. Example:
{ "A": "#FF0000", "T": "blue", 12: "#00FFFF" }style (={})
Style for seqviz's outer container div. Empty by default. Useful for setting the height and width of the viewer if the element around seqviz lacks a defined height and/or width. For example:
style: { height: "100vh", width: "100vw" }onSelection (=null)
Callback function executed after selection events. Should accept a single selection argument: (selection) => {}.
This occurs after drag/drop selection and clicks. If an annotation, translation, enzyme or searchElement was
clicked, the selection object will have info on the selected element. The example below is of a selection object
following an annotation click.
{
// selection
"name": "lacZ fragment",
"type": "ANNOTATION",
"seq": "ctatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgaattcgtaatcatggtcat",
"gc": 55.3,
"tm": 85,
"start": 133,
"end": 457,
"length": 324,
"direction": -1
"clockwise": true,
"color": "#8FDE8C",
}search (=null)
A search object for specifying search results to highlight on the viewer. An example is below:
{ "query": "aatggtctc", "mismatch": 1 }Searching supports the following nucleotide wildcards within the query.
{
"y": ["c", "t"],
"r": ["a", "g"],
"w": ["a", "t"],
"s": ["c", "g"],
"k": ["g", "t"],
"m": ["a", "c"],
"d": ["a", "g", "t"],
"v": ["a", "c", "g"],
"h": ["a", "c", "t"],
"b": ["c", "g", "t"],
"x": ["a", "c", "g", "t"],
"n": ["a", "c", "g", "t"]
}mismatch is an int denoting the maximum allowable mismatch between the query and a match within the viewer's
sequence (see: Hamming distance).
onSearch (=null)
Callback executed after a search event with a searchResults object. Called once on initial render. An example of searchResults is below:
[
{
start: 728,
end: 733,
direction: 1,
index: 0,
},
{
start: 1788,
end: 1793,
direction: -1,
index: 1,
},
];copyEvent (=(KeyboardEvent) => false)
A functions that returns whether to copy the selected range on the viewer(s) to the user's clipboard.
An example of an copyEvent function for copying after ctrl+c or meta+c events:
copyEvent: event => event.key === "c" && (event.metaKey || event.ctrlKey);rotateOnScroll (=true)
By default, the circular viewer rotates when scrolling over the viewer. That can be disabled with rotateOnScroll: false.
backbone (='')
This is a feature specific to BioBricks (accession). The library currently supports BBa_K1362091, BBa_K823055, pSB1A3, pSB1A7, pSB1AC3, pSB1AK3, pSB1AT3, pSB1C3, pSB1K3, and pSB1T3.
Custom backbones, as DNA strings, are also supported (for example: ATGATATAGAT).
highlightedRegions (=null)
Passing in a list of ranges will highlight those regions on top of the sequence. A default color from colors is used if none is provided.
highlightedRegions: [
{ start: 36, end: 66, color: "magenta" },
{ start: 70, end: 80 },
];Viewer without React
For usability in non-React apps, we provide a thin wrapper around the React component. The viewer's constructor accepts two arguments:
element: either a string id attribute like"root"or"app-root"or an element; e.g. fromdocument.getElementById()props: props as documented above
var viewer = seqviz.Viewer(element, props);
// Render the viewer to the DOM at the node passed in `${element}`.
viewer.render();
// Update the viewer's configuration and re-renders.
viewer.setState(props);
// Render the viewer and returns it as an HTML string.
viewer.renderToString();Demo
You can see a demonstration with iGEM BioBricks at: tools.latticeautomation.com/seqviz.
For developers, the demo source code is at seqviz/demo.
You can also check out an example of using SeqViz to view NCBI GenBank entries in our Medium post.
Contact Us
This library is maintained by Lattice Automation.
You can report bugs and request features at Issues, or contact us directly at [email protected]
