@rnacanvas/app-object
v15.6.4
Published
The RNAcanvas app object
Readme
The RNAcanvas app object encapsulates an entire RNAcanvas app instance.
Installation
With npm:
npm install @rnacanvas/app-objectUsage
Imports
// the RNAcanvas app object constructor
import { RNAcanvas } from '@rnacanvas/app-object';Creating a new RNAcanvas app object
var app = new RNAcanvas();Adding an RNAcanvas app instance to the document
It is important that an RNAcanvas app object be added to the document of a webpage since much of the underlying functionality related to SVG drawing only works for elements that have been added to the document.
// can also be added to any container node
app.appendTo(document.body);
// remove the RNAcanvas app object from its parent container node
app.remove();The DOM node reference
The DOM node corresponding to an RNAcanvas app instance
contains all of the elements that comprise an RNAcanvas app instance
and can be accessed using the domNode property.
The DOM node reference can be used to set certain styles of an RNAcanvas app instance
(e.g., width and height).
However, the internal contents and styling of the DOM node corresponding to an RNAcanvas app instance are not meant to be directly edited by outside code.
app.domNode;
app.domNode.style.width = '600px';
app.domNode.style.height = '400px';The style property
For convenience, a style property is also provided
that simply forwards to the style property of the DOM node
corresponding to an RNAcanvas app instance.
app.style.width = '600px';
app.style.height = '750px';The drawing of the app
The drawing of an RNAcanvas app instance represents an SVG document that is a two-dimensional nucleic acid structure drawing.
app.drawing;Drawing structures
For convenience, structures expressed in dot-bracket notation
can be drawn using the drawDotBracket method,
which will append the specified structure to the drawing of the app.
Note that this method alone will not adjust the padding of the drawing or the user's view of the drawing after a structure has been drawn.
var seq = 'AGAGUAGCAUUCUGCUUUAGACUGUUAACUUUAUGAACCACGCGUGUCACGUGGGGAGAGUUAACAGCGCCC';
var dotBracket = '(((((((....)))))))...(((((((((((.....(((((.......)))))..))))))))))).....';
app.drawDotBracket(seq, dotBracket);
// ensure that the drawn structure fits inside the drawing
// (and include some extra space around the drawn structure)
app.drawing.setPadding(200);
app.drawingView.fitToContent();The user's view of the drawing
The user's view of the drawing of the app is represented by the drawingView interface.
app.drawingView;
// the center point of the user's view of the drawing (in drawing coordinates)
app.drawingView.centerPoint = { x: 557, y: 1825 };
app.drawingView.centerPoint; // { x: 557, y: 1825 }
// adjusts the scaling of the drawing and scrollbar positions
// (to fit the content of the drawing all on screen)
app.drawingView.fitToContent();The currently selected elements
The selectedSVGElements property represents the set of currently selected SVG elements
in the drawing of the app.
app.selectedSVGElements.addAll([...app.drawing.secondaryBonds].slice(10, 20).map(sb => sb.domNode));
[...app.selectedSVGElements].forEach(ele => {
ele.setAttribute('stroke', 'blue');
ele.setAttribute('stroke-width', '3');
ele.setAttribute('stroke-linecap', 'round');
});
app.selectedSVGElements.include([...app.drawing.secondaryBonds][10].domNode); // true
app.selectedSVGElements.removeAll([...app.drawing.secondaryBonds].slice(5, 12).map(sb => sb.domNode));
app.selectedSVGElements.include([...app.drawing.secondaryBonds][10].domNode); // false
app.selectedSVGElements.clear();
[...app.drawing.secondaryBonds].every(sb => !app.selectedSVGElements.include(sb.domNode)); // trueThe currently selected SVG elements can also be listened to for when they change.
var numSelectedSVGElements = [...app.selectedSVGElements].length;
app.selectedSVGElements.addEventListener('change', () => numSelectedSVGElements = [...app.selectedSVGElements].length);Similarly, the selectedBases property represents the currently selected set of bases
in the drawing of the app.
let numSelectedBases = [...app.selectedBases].length;
app.selectedBases.addEventListener('change', () => numSelectedBases = [...app.selectedBases].length);
app.selectedBases.addAll([...app.drawing.bases].slice(25, 50));
numSelectedBases; // 25
app.selectedBases.include([...app.drawing.bases][25]); // true
app.selectedBases.include([...app.drawing.bases][24]); // falseThe selectAll method can also be used to select all elements in the drawing of the app.
app.selectAll();Opening forms
Forms can be opened using the openForm method.
// for controlling the layout of bases in the drawing of the app
app.openForm(app.basesLayoutForm);
// for exporting the drawing (e.g., as an SVG image)
app.openForm(app.exportForm);In general, any element with absolute positioning
(i.e., with a position CSS style of absolute)
could potentially be opened as a custom form in an RNAcanvas app instance.
var customForm = document.createElement('div');
customForm.textContent = 'A custom form.';
customForm.style.position = 'absolute';
customForm.style.left = '50px';
customForm.style.top = '50px';
app.openForm(customForm);Alternatively, a wrapping object can be opened as a form
(i.e., input to the openForm method)
so long as it fulfills the Form interface below.
interface Form {
/**
* Appends the DOM node corresponding to the form to the provided container node.
*/
appendTo(container: Node): void;
}Forms are positioned relative to the bounding box of the RNAcanvas app instance.
Forms are closed by simply removing them
(i.e., by calling the remove method on their corresponding DOM nodes).
Forms can be made draggable by applying the DragTranslater class of the @rnacanvas/forms package to them.
closeForm()
Closes the topmost form.
Does nothing if no forms are open.
app.closeForm();closeAllForms()
Closes all currently open forms.
Does nothing if no forms are open.
app.closeAllForms();exportSVG()
Downloads the drawing for the user in its current state (including its current level of zoom) as an SVG image.
app.exportSVG();exportPNG()
Downloads the drawing for the user in its current state (including its current level of zoom) as a PNG image.
app.exportPNG();exportJPEG()
Downloads the drawing for the user in its current state (including its current level of zoom) as a JPEG image.
app.exportJPEG();newTab()
Opens a new blank tab of the RNAcanvas app.
app.newTab();duplicateTab()
Opens a new duplicate tab of the RNAcanvas app (i.e., a tab with the same URL parameters).
Known issue #1: This method cannot currently recreate (in the new duplicate tab) edits to the drawing that the user has made.
To open a new tab of the drawing exactly as is (i.e., with all edits preserved),
download a .rnacanvas file of the drawing
and open the .rnacanvas file in a new tab of the RNAcanvas app.
Known issue #2: This method only works if the RNAcanvas URL interface was used in the first place to draw the drawing currently being shown.
app.duplicateTab();This method will omit the peripheral_ui URL parameter from the new tab
so that it is always opened with a full peripheral UI.
(This is a useful property of this method when the RNAcanvas app is currently embedded in another website without the full peripheral UI being shown.)
