npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2026 – Pkg Stats / Ryan Hefner

@rnacanvas/code

v17.3.0

Published

Flexible nucleic acid structure drawing

Readme

RNAcanvas 2.0 is a web app for flexible and reliable drawing of nucleic acid structures.

Console Interaction

RNAcanvas 2.0 can be interacted with using the web browser console.

The web browser console can be opened by pressing Ctrl+Shift+I (or Cmd+Option+I on Mac) and switching to the console tab.

Quickstart

Drawing a structure

// the structure to draw
var seq = 'AGAGUAGCAUUCUGCUUUAGACUGUUAACUUUAUGAACCACGCGUGUCACGUGGGGAGAGUUAACAGCGCCC';
var dotBracket = '(((((((....)))))))...(((((((((((.....(((((.......)))))..))))))))))).....';

app.drawDotBracket(seq, dotBracket);

// add some extra space around the drawn structure
// (and ensure that the drawing is big enough for the drawn structure)
app.drawing.setPadding(500);

// fit the user's view of the drawing to the drawn structure
app.drawingView.fitToContent();

Drawing from schema

RNA 2D JSON schemas (generated by tools such as R2DT) can be directly drawn.

// a URL to an RNA 2D JSON schema
var schemaURL = 'https://www.ebi.ac.uk/Tools/services/rest/r2dt/result/r2dt-R20240905-135809-0737-54467708-p1m/json';

fetch(schemaURL)
  .then(response => response.text())
  .then(text => app.drawSchema(JSON.parse(text)))
  // ensure the drawing is big enough to fit the drawn structure
  .then(() => app.drawing.setPadding(1000))
  // fit the user's view of the drawing to the drawn structure
  .then(() => app.drawingView.fitToContent());

Note that this method may throw for invalid schemas, in which case the drawing of the app may be left in a partially drawn state (e.g., with only part of a schema having been drawn).

Controlling the layout of bases

See the full documentation for the @rnacanvas/bases-layout package.

// all bases in the drawing
var bases = [...app.drawing.bases];

// shift the bases by the given vector
shift(bases, { x: 500, y: -350 });

// rotate the bases by 120 degrees clockwise
rotate(bases, 2 * Math.PI / 3);

// represents the central point of all bases
var centroid = new Centroid(bases);

// recenter the bases at (912, 204)
centroid.set({ x: 912, y: 204 });
centroid.get(); // { x: 912, y: 204 }

// all base-pairs in the secondary structure of the drawing
var basePairs = [...app.drawing.secondaryBonds].map(sb => [...sb.basePair]];

// untangle the bases
// (the default layout for the bases in a structure)
untangle(bases, basePairs, { spacing: 20, basePairSpacing: 10, hairpinLoopSpacing: 10 });

Editing and styling drawing elements

Attributes and properties of elements in the drawing of the app can be directly accessed and set.

// make all U's lowercase and red
[...app.drawing.bases].filter(b => b.textContent === 'U').forEach(b => {
  b.textContent = 'u';
  b.setAttribute('fill', 'red');
});

// trace the sequence of the structure
[...app.drawing.primaryBonds].forEach(pb => {
  pb.set({
    basePadding1: 0,
    basePadding2: 0,
    attributes: {
      'stroke': 'blue',
      'stroke-width': '2',
      'stroke-linecap': 'round',
    },
  });
});

// give all secondary bonds a line thickness of 3 and rounded ends
[...app.drawing.secondaryBonds].forEach(sb => {
  sb.setAttributes({
    'stroke-width': '3',
    'stroke-linecap': 'round',
  });
});

Exporting a drawing

Drawings can be exported in SVG format, which can be opened (and edited further) in vector graphics softwares like Adobe Illustrator and Inkscape.

// the outer HTML of the drawing is SVG XML that can be exported
var file = new DownloadableFile(app.drawing.outerHTML);

file.downloadAs('drawing.svg', { type: 'text/plain' });

The RNAcanvas app object

The RNAcanvas app object (accessible via the app global variable) represents the entire RNAcanvas app.

// the RNAcanvas app object
app

// the nucleic acid structure drawing of the app
app.drawing

// the scrollbars for the drawing
app.horizontalDrawingScrollbar
app.verticalDrawingScrollbar

// represents the user's view of the drawing
// (can be used to fit the user's view to the drawn structure, for instance)
app.drawingView

var seq = 'AAAAGAUAGCCUCCCUCCUCGCGCGGGGGGGGGGCCUGCCC';
var dotBracket = '........(((((((((((.....)))))))))))......';

// appends the provided dot-bracket structure to the drawing of the app
app.drawDotBracket(seq, dotBracket);