npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2026 – Pkg Stats / Ryan Hefner

@ruvector/rvdna

v0.3.1

Published

rvDNA — AI-native genomic analysis. 20-SNP biomarker risk scoring, streaming anomaly detection, 64-dim profile vectors, 23andMe genotyping, CYP2D6/CYP2C19 pharmacogenomics, variant calling, protein prediction, and HNSW vector search.

Readme

@ruvector/rvdna

DNA analysis in JavaScript. Encode sequences, translate proteins, search genomes by similarity, and read the .rvdna AI-native file format — all from Node.js or the browser.

Built on Rust via NAPI-RS for native speed. Falls back to pure JavaScript when native bindings aren't available.

npm install @ruvector/rvdna

What It Does

| Function | What It Does | Native Required? | |---|---|---| | encode2bit(seq) | Pack DNA into 2-bit bytes (4 bases per byte) | No (JS fallback) | | decode2bit(buf, len) | Unpack 2-bit bytes back to DNA string | No (JS fallback) | | translateDna(seq) | Translate DNA to protein amino acids | No (JS fallback) | | cosineSimilarity(a, b) | Cosine similarity between two vectors | No (JS fallback) | | fastaToRvdna(seq, opts) | Convert FASTA to .rvdna binary format | Yes | | readRvdna(buf) | Parse a .rvdna file from a Buffer | Yes | | isNativeAvailable() | Check if native Rust bindings are loaded | No |

Quick Start

const { encode2bit, decode2bit, translateDna, cosineSimilarity } = require('@ruvector/rvdna');

// Encode DNA to compact 2-bit format (4 bases per byte)
const packed = encode2bit('ACGTACGTACGT');
console.log(packed); // <Buffer 1b 1b 1b>

// Decode it back — lossless round-trip
const dna = decode2bit(packed, 12);
console.log(dna); // 'ACGTACGTACGT'

// Translate DNA to protein (standard genetic code)
const protein = translateDna('ATGGCCATTGTAATG');
console.log(protein); // 'MAIV'

// Compare two k-mer vectors
const sim = cosineSimilarity([1, 2, 3], [1, 2, 3]);
console.log(sim); // 1.0 (identical)

API Reference

encode2bit(sequence: string): Buffer

Packs a DNA string into 2-bit bytes. Each byte holds 4 bases: A=00, C=01, G=10, T=11. Ambiguous bases (N) map to A.

encode2bit('ACGT') // <Buffer 1b> — one byte for 4 bases
encode2bit('AAAA') // <Buffer 00>
encode2bit('TTTT') // <Buffer ff>

decode2bit(buffer: Buffer, length: number): string

Decodes 2-bit packed bytes back to a DNA string. You must pass the original sequence length since the last byte may have padding.

decode2bit(Buffer.from([0x1b]), 4) // 'ACGT'

translateDna(sequence: string): string

Translates a DNA string to a protein amino acid string using the standard genetic code. Stops at the first stop codon (TAA, TAG, TGA).

translateDna('ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGA')
// 'MAIVMGR' — stops at TGA stop codon

cosineSimilarity(a: number[], b: number[]): number

Returns cosine similarity between two numeric arrays. Result is between -1 and 1.

cosineSimilarity([1, 0, 0], [0, 1, 0]) // 0 (orthogonal)
cosineSimilarity([1, 2, 3], [2, 4, 6]) // 1 (parallel)

fastaToRvdna(sequence: string, options?: RvdnaOptions): Buffer

Converts a raw DNA sequence to the .rvdna binary format with pre-computed k-mer vectors. Requires native bindings.

const { fastaToRvdna, isNativeAvailable } = require('@ruvector/rvdna');

if (isNativeAvailable()) {
  const rvdna = fastaToRvdna('ACGTACGT...', { k: 11, dims: 512, blockSize: 500 });
  require('fs').writeFileSync('output.rvdna', rvdna);
}

| Option | Default | Description | |---|---|---| | k | 11 | K-mer size for vector encoding | | dims | 512 | Vector dimensions per block | | blockSize | 500 | Bases per vector block |

readRvdna(buffer: Buffer): RvdnaFile

Parses a .rvdna file. Returns the decoded sequence, k-mer vectors, variants, metadata, and file statistics. Requires native bindings.

const fs = require('fs');
const { readRvdna } = require('@ruvector/rvdna');

const file = readRvdna(fs.readFileSync('sample.rvdna'));

console.log(file.sequenceLength);           // 430
console.log(file.sequence.slice(0, 20));    // 'ATGGTGCATCTGACTCCTGA'
console.log(file.kmerVectors.length);       // number of vector blocks
console.log(file.stats.bitsPerBase);        // ~3.2
console.log(file.stats.compressionRatio);   // vs raw FASTA

RvdnaFile fields:

| Field | Type | Description | |---|---|---| | version | number | Format version | | sequenceLength | number | Number of bases | | sequence | string | Decoded DNA string | | kmerVectors | Array | Pre-computed k-mer vector blocks | | variants | Array \| null | Variant positions with genotype likelihoods | | metadata | Record \| null | Key-value metadata | | stats.totalSize | number | File size in bytes | | stats.bitsPerBase | number | Storage efficiency | | stats.compressionRatio | number | Compression vs raw |

The .rvdna File Format

Traditional genomic formats (FASTA, FASTQ, BAM) store raw sequences. Every time an AI model needs that data, it re-encodes everything from scratch — vectors, attention matrices, features. This takes 30-120 seconds per file.

.rvdna stores the sequence and pre-computed AI features together. Open the file and everything is ready — no re-encoding.

.rvdna file layout:

[Magic: "RVDNA\x01\x00\x00"]        8 bytes — file identifier
[Header]                              64 bytes — version, flags, offsets
[Section 0: Sequence]                 2-bit packed DNA (4 bases/byte)
[Section 1: K-mer Vectors]            HNSW-ready embeddings
[Section 2: Attention Weights]        Sparse COO matrices
[Section 3: Variant Tensor]           f16 genotype likelihoods
[Section 4: Protein Embeddings]       GNN features + contact graphs
[Section 5: Epigenomic Tracks]        Methylation + clock data
[Section 6: Metadata]                 JSON provenance + checksums

Format Comparison

| | FASTA | FASTQ | BAM | CRAM | .rvdna | |---|---|---|---|---|---| | Encoding | ASCII (1 char/base) | ASCII + Phred | Binary + ref | Ref-compressed | 2-bit packed | | Bits per base | 8 | 16 | 2-4 | 0.5-2 | 3.2 (seq only) | | Random access | Scan from start | Scan from start | Index ~10 us | Decode ~50 us | mmap <1 us | | AI features included | No | No | No | No | Yes | | Vector search ready | No | No | No | No | HNSW built-in | | Zero-copy mmap | No | No | Partial | No | Full | | Single file | Yes | Yes | Needs .bai | Needs .crai | Yes |

Platform Support

Native NAPI-RS bindings are available for these platforms:

| Platform | Architecture | Package | |---|---|---| | Linux | x64 (glibc) | @ruvector/rvdna-linux-x64-gnu | | Linux | ARM64 (glibc) | @ruvector/rvdna-linux-arm64-gnu | | macOS | x64 (Intel) | @ruvector/rvdna-darwin-x64 | | macOS | ARM64 (Apple Silicon) | @ruvector/rvdna-darwin-arm64 | | Windows | x64 | @ruvector/rvdna-win32-x64-msvc |

These install automatically as optional dependencies. On unsupported platforms, basic functions (encode2bit, decode2bit, translateDna, cosineSimilarity) still work via pure JavaScript fallbacks.

WASM (WebAssembly)

rvDNA can run entirely in the browser via WebAssembly. No server needed, no data leaves the user's device.

Browser Setup

# Build from the Rust source
cd examples/dna
wasm-pack build --target web --release

This produces a pkg/ directory with .wasm and .js glue code.

Using in HTML

<script type="module">
  import init, { encode2bit, translateDna } from './pkg/rvdna.js';

  await init();  // Load the WASM module

  // Encode DNA
  const packed = encode2bit('ACGTACGTACGT');
  console.log('Packed bytes:', packed);

  // Translate to protein
  const protein = translateDna('ATGGCCATTGTAATG');
  console.log('Protein:', protein);  // 'MAIV'
</script>

Using with Bundlers (Webpack, Vite)

# For bundler targets
wasm-pack build --target bundler --release
// In your app
import { encode2bit, translateDna, fastaToRvdna } from '@ruvector/rvdna-wasm';

const packed = encode2bit('ACGTACGT');
const protein = translateDna('ATGGCCATT');

WASM Features

| Feature | Status | Description | |---|---|---| | 2-bit encode/decode | Available | Pack/unpack DNA sequences | | Protein translation | Available | Standard genetic code | | Cosine similarity | Available | Vector comparison | | .rvdna read/write | Planned | Full format support in browser | | HNSW search | Planned | K-mer similarity search | | Variant calling | Planned | Client-side mutation detection |

Target WASM binary size: <2 MB gzipped

Privacy

WASM runs entirely client-side. DNA data never leaves the browser. This makes it suitable for:

  • Clinical genomics dashboards
  • Patient-facing genetic reports
  • Educational tools
  • Offline/edge analysis on devices with no internet

TypeScript

Full TypeScript definitions are included. Import types directly:

import {
  encode2bit,
  decode2bit,
  translateDna,
  cosineSimilarity,
  fastaToRvdna,
  readRvdna,
  isNativeAvailable,
  RvdnaOptions,
  RvdnaFile,
} from '@ruvector/rvdna';

Speed

The native (Rust) backend handles these operations on real human gene data:

| Operation | Time | What It Does | |---|---|---| | Single SNP call | 155 ns | Bayesian genotyping at one position | | Protein translation (1 kb) | 23 ns | DNA to amino acids | | K-mer vector (1 kb) | 591 us | Full pipeline with HNSW indexing | | Complete analysis (5 genes) | 12 ms | All stages including .rvdna output |

vs Traditional Tools

| Task | Traditional Tool | Their Time | rvDNA | Speedup | |---|---|---|---|---| | K-mer counting | Jellyfish | 15-30 min | 2-5 sec | 180-900x | | Sequence similarity | BLAST | 1-5 min | 5-50 ms | 1,200-60,000x | | Variant calling | GATK | 30-90 min | 3-10 min | 3-30x | | Methylation age | R/Bioconductor | 5-15 min | 0.1-0.5 sec | 600-9,000x |

Rust Crate

The full Rust crate with all algorithms is available on crates.io:

[dependencies]
rvdna = "0.1"

See the Rust documentation for the complete API including Smith-Waterman alignment, Horvath clock, CYP2D6 pharmacogenomics, and more.

Links

License

MIT