alignment-viewer
v0.3.4
Published
A simple widget for visualizing genetic sequence alignments
Downloads
84
Readme
AlignmentViewer
Alignment Viewer is a simple, dependency-free widget to visualize multiple genome sequences.
This repository was created for use by CDC programs to collaborate on public health surveillance related projects in support of the CDC Surveillance Strategy. Github is not hosted by the CDC, but is used by CDC and its partners to share information and collaborate on software.
Demo
sequences = [
'ACTGACTAGCTAGCTAACTG',
'GCATCGTAGCTAGCTACGAT',
'CATCGATCGTACGTACGTAG',
'ATCGATCGATCGTACGATCG'
];
alignmentViewer(sequences).then(function(canvas){
document.body.appendChild(canvas);
});See the Source Code of the Demo for a slightly fleshier live version.
Syntax
alignmentViewer(seqs, config) where:
seqs- an array of sequence stringsconfig- OPTIONAL, an object containing any of the following attributes:config.width- OPTIONAL, the width (in pixels) of each cell. Please note that this is not the width of the output figure. Defaults to 10config.height- OPTIONAL, the height (in pixels) of each cell. Please note that this is not the height of the output figure. Defaults to 10config.showChar- OPTIONAL, should the character be rendered in the cell? Defaults to false. Use with caution, significantly slows down rendering.config.colors- OPTIONAL, an object mapping from the nucleotide to the color of the corresponding cell in the output image. Defaults to the Taylor color scheme:
{
'A' : 'lightgreen',
'G' : 'orange',
'C' : 'yellow',
'T' : 'red',
'ambig': 'white'
}Fun fact: It's actually alphabet-agnostic, so you can map any character to a color and see it. So you can visualize, say, protein sequences by just setting config.colors to an object mapping from the IUPAC 1-letter codes to the desired color.
Isn't this what MSAViewer is for?
Yup.
So why build another?
MSAViewer is an awesome App. However, it's a difficult widget. What I mean is, it works great on pages where it's the only thing happening. But it has some annoying behaviors. For example, it imports underscore. While this is fine and common, it overwrites window._, which is a huge annoyance when you're using, say lodash.
A big cause of this is the simple fact that MSAViewer does too much. I want a widget that can visualize sequences to judge their alignments at a glance. To accomplish this, I don't need: Fasta importing and exporting (from URLs OR Local files), Consensus Computation, Motif searching, Sorting, filtering, etc. I mean, all of these are cool features, but they should be more available to the programmer than they are to the user. MSAViewer is based on sort-of the opposite principle. It's surprisingly difficult to customize which of these features are made available to the user within MSAViewer. That's how it became a great app, but a terrible widget.
OK, so what does this do?
It draws large numbers of enormous sequences blisteringly fast using HTML5's Canvas API. In case you have so many sequences that are so long it begins to get sluggish, it's also promise-based, so you can manage it asynchronously.
Anything else?
Not really, but down the road, I may add some complementary visual elements like sequence logos or gap weights. If you need that stuff, please let me know. Until you do, they're a distant second priority.
Public Domain
This repository constitutes a work of the United States Government and is not subject to domestic copyright protection under 17 USC § 105. This repository is in the public domain within the United States, and copyright and related rights in the work worldwide are waived through the CC0 1.0 Universal public domain dedication. All contributions to this repository will be released under the CC0 dedication. By submitting a pull request you are agreeing to comply with this waiver of copyright interest.
License
The repository utilizes code licensed under the terms of the Apache Software License and therefore is licensed under ASL v2 or later.
This source code in this repository is free: you can redistribute it and/or modify it under the terms of the Apache Software License version 2, or (at your option) any later version.
This soruce code in this repository is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the Apache Software License for more details.
You should have received a copy of the Apache Software License along with this program. If not, see http://www.apache.org/licenses/LICENSE-2.0.html
The source code forked from other open source projects will inherit its license.
Privacy
This repository contains only non-sensitive, publicly available data and information. All material and community participation is covered by the Surveillance Platform Disclaimer and Code of Conduct. For more information about CDC's privacy policy, please visit http://www.cdc.gov/privacy.html.
Contributing
Anyone is encouraged to contribute to the repository by forking and submitting a pull request. (If you are new to GitHub, you might start with a basic tutorial.) By contributing to this project, you grant a world-wide, royalty-free, perpetual, irrevocable, non-exclusive, transferable license to all users under the terms of the Apache Software License v2 or later.
All comments, messages, pull requests, and other submissions received through CDC including this GitHub page are subject to the Presidential Records Act and may be archived. Learn more at http://www.cdc.gov/other/privacy.html.
Records
This repository is not a source of government records, but is a copy to increase collaboration and collaborative potential. All government records will be published through the CDC web site.
Notices
Please refer to CDC's Template Repository for more information about contributing to this repository, public domain notices and disclaimers, and code of conduct.
