npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2026 – Pkg Stats / Ryan Hefner

c6-sim

v1.0.11

Published

Multiplatform molecular biology construction simulator

Downloads

61

Readme

C6-Multiplatform

Cross-platform toolkit for synthetic biology and molecular biology operations

npm version
jsDelivr hits


Overview

C6 is a JavaScript toolkit for simulating recombinant DNA workflows. It supports both browser-based and Node.js-based execution environments, enabling use in web applications, teaching tools, or backend design pipelines.

The central abstraction in C6 is the Construction File (CF) — a stepwise text specification describing a DNA assembly plan using PCR, restriction digest, Gibson assembly, Golden Gate cloning, transformation, and other procedures. C6 parses CFs into structured instructions and simulates the resulting chemical outcomes using modeled reactions. The Construction File format is introduced in Anderson et al., 2023, which provides the conceptual foundation for this abstraction.

C6 models DNA molecules using a Polynucleotide abstraction that reflects the physical and chemical properties of DNA fragments used in recombinant DNA procedures. This includes parameters such as strandedness (single or double), topology (linear or circular), RNA vs DNA, and 5′/3′ overhangs or modifications. Helper constructors are provided for common cases (e.g., dsDNA, oligo, plasmid), but the Polynucleotide class itself generalizes any linear or circular molecule encountered in assembly workflows.

Beyond simulation, C6 includes design and verification tools:

  • Oligo design utilities for standard assembly schemes (e.g., BioBrick, MoClo, BglBrick, RBSLib)
  • Annotation and inference tools that map known features to sequences, group them into transcriptional units (TUs), and infer which CDS elements are likely expressed
  • Sequence manipulation utilities for reverse complementation, melting temperature, self-complementarity checks, and more

C6 focuses on modeling the chemical logic of molecular biology protocols rather than abstract logic of synthetic circuits. It is useful for applications involving validation, verification, or generation of DNA designs in formats that correspond closely to wet-lab workflows and in vitro molecular biology techniques.

C6 is not a compositional design tool. It does not attempt to optimize or select parts for a genetic circuit, metabolic pathway, or regulatory network. Instead, it assumes a design has already been made and focuses on the molecular construction strategy that will realize it. It verifies that a Construction File is syntactically well-formed, chemically coherent, and capable of producing the intended DNA product in silico. It also provides limited analysis of potential gene expression from the resulting constructs. While C6 does not yet generate detailed wet-lab protocols or robotic instructions, it offers a foundation for that by providing precise modeling of DNA species and cloning operations.


Installation

npm install c6-sim

Or load via CDN:

<script src="https://cdn.jsdelivr.net/npm/c6-sim/dist/c6-sim.min.js"></script>

Quickstart

You can use C6 to simulate recombinant DNA steps in Node.js or in the browser.

import C6 from 'c6-sim';

const cfText = `
PCR Fwd Rev Template Product
oligo Fwd CAAGTGGGAACGCGTAATG
oligo Rev CGGTCACGGCACCACCATC
plasmid Template TTCAAGTGGGAACGCGTAATGAATTTTGAAGATGGTGGTGCCGTGACCG
`;

const cf = C6.parseCF(cfText);
const result = C6.simCF(cf);
console.log(result);

Interactive Demo

You can try the toolkit in your browser using the hosted demo:

👉 C6 Interactive Demo

This includes CF simulation, annotation, and expression inference in a no-install playground.


Running Tests

This project uses Vitest:

npm test

Test coverage includes core simulation, sequence utilities, oligo design, and gene annotation.


Repository

GitHub – UCB BioE Anderson Lab


License

MIT License © University of California, Berkeley