npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2026 – Pkg Stats / Ryan Hefner

cgparse

v1.1.2

Published

Converts sequence files (GenBank, EMBL, FASTA) and feature files (GFF3, GTF, BED, CSV) to JSON and CGView JSON

Downloads

51

Readme

CGParse.js

Pages Status Tests Status Last Commit License npm version bundle size jsDelivr hits

CGParse.js is a lightweight JavaScript library for parsing biological sequence and feature files (GenBank, EMBL, FASTA, GFF3, BED, etc.). It converts these files into CGView-compatible JSON, making them ready for visualization with CGView.js.

🔗 Live Demo & Test Page

Table of Contents

Installation

CGParse.js has no dependencies. Install it from npm or load it directly via jsDelivr.

Installing from npm

npm install cgparse
# or
yarn add cgparse

Installing as a script from jsDelivr

<script src="https://cdn.jsdelivr.net/npm/cgparse/dist/cgparse.min.js"></script>
<!-- CGParse will be available as a global variable -->

Quick Start

Create CGView JSON from a sequence file (e.g. GenBank, EMBL, FASTA)

import * as CGParse from 'cgparse'

// Create a string for the sequence file.
// The sequence string can be in GenBank, EMBL or FASTA format.
// Here we show a FASTA example for brevity.
const seqString = `>Sequence_Example
atgtccgacccaccggtcgaaaaaacaagtccagagaagacagagggctcttcatccggcagttttcgcgtcccactcgaatccgacaagcttggtgacccggatttcaagccatgcgtt
gcacaaatcacaatggagagaaacgcagtgttcgaggacaacttcctcgatcggagacagagtgctcgcgccgtaatcgagtattgctttgaggacgaaatgcaaaacttggttgaaggg
cgacctgctgtttcagaagaaccagttgttcccatacgattccgacgcccaccaccgtccggacctgctcacgacgtctttggcgacgccatgaacgaaattttccagaaattaatgatg
aaaggtcaatgcgcagacttctgccactggatggcttattggctaacaaaggaacaagatgatgcgaatgatggattttttggcaatattcgctataatccagatgtctatgtcacggaa
ggcacaacagaaaccaaaaaggcgttcgtcgacagcatgtggccgactgctcagcgaattcttctgaaatccgtccggaacagcacgattttacgcacaaagtggactggaatccacgtg
tcagcggatcagttgaaggggcaacgcccgaagcaagaagatagattcgtagcttatccgaatagtcagtatatgaatcggacgcaggatcccgtcgcccttctcggtgtgttcgatggt
catggcggacacgagtgctcacaatacgcggcctctcacttctgggaggcatggctggagactcgacaaactagcgacggtgatgagctccagaatcagctgaagaagtcacttgagttg
ttggatcaacgattgacagtcagaagtgtgaaggaatactggaagggtggcactacggcggcgtgttgcgctatcgataaggagaacaaaacgatggcgttcgcgtggttgggcgattca
ccaggatacgtcatgaacaacatggaattccgcaaagtga`;

// Create a new CGView builder for the sequence
const cgvBuilder = new CGParse.CGViewBuilder(seqString);

// Convert to CGView JSON
const cgviewJSON = cgvBuilder.toJSON();

// The JSON can then be loaded into a previously created CGView.js instance
cgv.io.loadJSON(cgviewJSON);

Details on the CGView JSON format Tutorial on using CGParse.js with CGView.js

Create CGView Features from a feature file (e.g. CSV, GFF3, GTF, BED)

import * as CGParse from 'cgparse'

// Create a string for the feature file (e.g GFF3)
const gff3String = `##gff-version 3
chr1	.	gene	1000	2000	.	+	.	ID=gene1;Name=myGene`;
// Create a new feature builder for the features
const featureBuilder = new CGParse.FeatureBuilder(gff3String);
// Convert to an array of CGView features
const features = featureBuilder.toJSON();

// The features can then be added to a previously created CGView instance
cgv.addFeatures(features);

CGViewBuilder Options

const builder = new CGParse.CGViewBuilder(seqString, {
  // CGView configuration (see below for example)
  config: configJSON, 
  // The order of preference for the naming of a feature [Default shown]
  // The name for a feature will be taken from the first feature qualifier
  // in the list that has a value.
  // TODO: CONFIRM
  nameKeys: ['gene', 'locus_tag', 'product', 'note', 'db_xref'],
  // Feature types to exclude (see below for details on including/excluding features)
  excludeFeatures: ['gene', 'source', 'exon'],
  // Qualifiers types to exclude (see below for details on including/excluding features)
  excludeQualifiers: ['translation'],
});

Including/Excluding Feature Types and Qualifiers

When building from a GenBank or EMBL file, you can choose which features types (e.g. CDS, gene, rRNA) and qualifiers (e.g. product, note, locus_tag) to include or exclude. The default is to include all features and all their qualifiers.

// Include all features and their qualifiers [Default]
const builder = new CGParse.CGViewBuilder(seqString, {
  includeFeatures: true,    // [Default]
  includeQualifiers: true   // [Default]
})

// Include no features
const builder = new CGParse.CGViewBuilder(seqString, {
  includeFeatures: false,
  includeQualifiers: false  // [Not required, since there will not be any features]
})

// Include only specific features and their qualifiers
const builder = new CGParse.CGViewBuilder(seqString, {
  includeFeatures: ['CDS', 'rRNA'],
  includeQualifiers: ['product', 'note', 'locus_tag']
})

// Exclude a subset of features and their qualifiers
// Recommended settings for bacterial genomes
const builder = new CGParse.CGViewBuilder(seqString, {
  excludeFeatures: ['source', 'gene', 'exon'],
  excludeQualifiers: ['translation']
})

For list of qualifiers and feature types see the following resources:

CGViewBuilder Config

A config object can be provided to CGViewBuilder. The config is a JSON object with options that are added to the CGView JSON. They can be any settings available for the following components: settings, backbone, ruler, dividers, annotation, sequence, legend, track, captions

// Example Config
let configJSON = {
  "settings": {
    "backgroundColor": "white",
    "showShading": true,
    "arrowHeadLength": 0.3
  },
  "ruler": {
    "font": "sans-serif, plain, 10",
    "color": "black"
  },
  "legend": {
    "position": "top-right",
    "defaultFont": "sans-serif, plain, 14",
    "items": [
      {
        "name": "CDS",
        "swatchColor": "rgba(0,0,153,0.5)",
        "decoration": "arrow"
      }
    ]
  },
  "tracks": [
    {
      "name": "CG Content",
      "thicknessRatio": 2,
      "position": "inside",
      "dataType": "plot",
      "dataMethod": "sequence",
      "dataKeys": "gc-content"
    },
    {
      "name": "CG Skew",
      "thicknessRatio": 2,
      "position": "inside",
      "dataType": "plot",
      "dataMethod": "sequence",
      "dataKeys": "gc-skew"
    }
  ],
  captions: [
    {
      // For name you can provide static text or use special keywords to get dynamic text
      name: "my map",         // Shows 'my map' as the caption
      // name: "DEFINITION",  // Shows the sequence definition (e.g. Escherichia coli str. K-12 substr. MG1655, complete genome.)
      // name: "ID",          // Shows the sequence accession/version (e.g. NC_000913.3)
      position: "bottom-center",
    },
  ]
}

Intermediate Sequence and Feature JSON formats

Internally CGViewBuilder and FeatureBuilder are first taking the input file and converting it to an intermediate JSON format that contains most of the data from the input file. This intermediate format could be used by other projects.

Sequence Files (GenBank, EMBL, FASTA)

import * as CGParse from 'cgparse';

// Parse sequence file (e.g. GenBank Accession AF177870.1)
// Showing truncated GenBank text here (full GenBank text below)
const genbankText = `LOCUS AF177870 3123 bp DNA...`;
// Parse GenBank
const seqFile = new CGParse.SequenceFile(genbankText);

// Summary
seqFile.summary;
// {
//   inputType: 'genbank',
//   sequenceType: 'dna',
//   sequenceCount: 1,
//   featureCount: 4,
//   totalLength: 3123,
//   status: 'success'
// }

// Array of parsed records as JSON
seqFile.records;

Records Output

[
  {
    "inputType": "genbank",
    "name": "AF177870",
    "seqID": "AF177870.1",
    "definition": "Caenorhabditis sp. CB5161 putative PP2C protein phosphatase FEM-2",
    "length": 3123,
    "topology": "linear",
    "type": "dna"
    "comments": "",
    "sequence": "gaacgcgaatgcctctctctctttcgatgggtatgccaattgtccacattcactcgtgttgcctcctctttgccaacacgcaagacaccagaaacgcgtcaaccaaagagaaaaagacgccgacaacgggcagcactcgcgagagacaaaggttatcgcgttgtgttattatacattcgcatccgggtcaactttagtccgttgaacatgcttcttgaaaacctagttctcttaaaataacgttttagaagttttggtcttcagatgtctgattcgctaaatcatccatcgagttctacggtgcatgcagatgatggattcgagccaccaacatctccggaagacaacaacaaaaaaccgtctttagaacaaattaaacaggaaagagaagcgttgtttacggttagttacctattagctgcaagttttgaaaaagcggaatctgtaaaaagcggaatctgtaaaaaaaacatctaaggaataattctgaaaagaaaaagtttctaaatgttaatcggaatccaatttttatgaaattatttaaaaaaaaactaaaattagtttctaaaaaatttttctaaagtaattggaccatgtgaaggtacacccacttgttccaatatgccatatctaactgtaaaataatttgattctcatgagaatatttttcaggatctattcgcagatcgtcgacgaagcgctcgttctgtgattgaagaagctttccaaaacgaactcatgagtgctgaaccagtccagccaaacgtgccgaatccacattgtgagttggaaatttttatttgataaccaagagaaaaaaagttctacctttttttcaaaaacctttccaaaaatgattccatctgatataggattaagaaaaatattttccgaaatctctgcttttcagcgattcccattcgtttccgtcatcaaccagttgctggacctgctcatgatgttttcggagacgcggtgcattcaatttttcaaaaaataatgtccaggtatacactatttttgcatatttttcttgccaaatttggtcaaaaaccgtagtacaacccaaaaagtttcttcatttcagaggagtgaacgcggattatagtcattggatgtcatattggatcgcgttgggaatcgacaaaaaaacacaaatgaactatcatatgaaaccgttttgcaaagatacttatgcaactgaaggctccttaggtaggttagtcttttctaggcacagaagagtgagaaaattctaaatttctgagcagtctgctttttgttttccttgagtttttacttaaagctcttaaaagaaatctaggcgtgaagttcgagccttgtaccataccacaacagcattccaaatgttacagaagcgaaacaaacatttactgataaaatcaggtcagctgttgaggaaattatctggaagtccgctgaatattgtgatattcttagcgagaagtggacaggaattcatgtgtcggccgaccaactgaaaggtcaaagaaataagcaagaagatcgttttgtggcttatccaaatggacaatacatgaatcgtggacaggttagtgcgaatcggggactcaagatttactgaaatagtgaagagaaaacaaaagaaaactatattttcaaaaaaaatgagaactctaataaacagaatgaaaaacattcaaagctacagtagtatttccagctggagtttccagagccaaaaaaatgcgagtattactgtagttttgaaattggtttctcactttacgtacgattttttgatttttttttcagactcttcatatgaaaaaaaatcatgttttctcctttacaagatttttttgatctcaaaacatttccagagtgacatttcacttcttgcggtgttcgatgggcatggcggacacgagtgctctcaatatgcagctgctcatttctgggaagcatggtccgatgctcaacatcatcattcacaagatatgaaacttgacgaactcctagaaaaggctctagaaacattggacgaaagaatgacagtcagaagtgttcgagaatcttggaaaggtggaaccactgctgtctgctgtgctgttgatttgaacactaatcaaatcgcatttgcctggcttggagattcaccagggtaatcaatttttttttagtttttggaactttacgtcccgaaaaattattcctttatcacctaattcctacagtaacccaagctccgaattaaataaagttaaagcgtggtatacacataaaaataagaaaaaattgttcatgaaatccatttttccagttacatcatgtcaaacttggagttccgcaaattcactactgaacactccccgtctgacccggaggaatgtcgacgagtcgaagaagtcggtggccagatttttgtgatcggtggtgagctccgtgtgaatggagtactcaacctgacgcgagcactaggagacgtacctggaagaccaatgatatccaacaaacctgataccttactgaagacgatcgaacctgcggattatcttgttttgttggcctgtgacgggatttctgacgtcttcaacactagtgatttgtacaatttggttcaggcttttgtcaatgaatatgacgtagaaggtatcaaactgatcgtttttcacatcacaaaattcttgaattttccagattatcacgaacttgcacgctacatttgcaatcaagcagtttcagctggaagtgctgacaatgtgacagtagttataggtttcctccgtccaccagaagacgtttggcgtgtaatgaaaacagactcggatgatgaagagagcgagctcgaggaagaagatgacaatgaatagtttattgcaagttttccaaaacttttccaatttccctgggtattgattagcatccatatcttacggcgattatatcaattgtaacattatttctgtttctccccccacctctcaaattttcaaatgaccctttttcttttcgtctacctgtatcgttttccattcatctccccccctccactgtggtatatcattttgtcattagaaagtattattttgattttcattggcagtagaagacaacaggatacagaagaggttttcacag",
    "features": [
      {
        "type": "source",
        "strand": 1,
        "locationText": "1..3123",
        "locations": [[1,3123]],
        "start": 1,
        "stop": 3123,
        "qualifiers": {
          "organism": "Caenorhabditis brenneri",
          "mol_type": "genomic DNA",
          "strain": "CB5161",
          "db_xref": "taxon:135651"
        },
        "name": "taxon:135651"
      },
      {
        "type": "gene",
        "strand": 1,
        "locationText": "<265..>2855",
        "locations": [[265,2855]],
        "start": 265,
        "stop": 2855,
        "qualifiers": {
          "gene": "fem-2"
        },
        "name": "fem-2"
      },
      {
        "type": "mRNA",
        "strand": 1,
        "locationText": "join(<265..402,673..781,911..1007,1088..1215,1377..1573,1866..2146,2306..2634,2683..>2855)",
        "locations": [[265,402],[673,781],[911,1007],[1088,1215],[1377,1573],[1866,2146],[2306,2634],[2683,2855]],
        "start": 265,
        "stop": 2855,
        "qualifiers": {
          "gene": "fem-2",
          "product": "putative FEM-2 protein phosphatase type 2C"
        },
        "name": "fem-2"
      },
      {
        "type": "CDS",
        "strand": 1,
        "locationText": "join(265..402,673..781,911..1007,1088..1215,1377..1573,1866..2146,2306..2634,2683..2855)",
        "locations": [[265,402],[673,781],[911,1007],[1088,1215],[1377,1573],[1866,2146],[2306,2634],[2683,2855]],
        "start": 265,
        "stop": 2855,
        "qualifiers": {
          "gene": "fem-2",
          "note": "possible sex-determining protein",
          "codon_start": "1",
          "product": "putative PP2C protein phosphatase FEM-2",
          "protein_id": "AAF04557.1",
          "translation": "MSDSLNHPSSSTVHADDGFEPPTSPEDNNKKPSLEQIKQEREALFTDLFADRRRSARSVIEEAFQNELMSAEPVQPNVPNPHSIPIRFRHQPVAGPAHDVFGDAVHSIFQKIMSRGVNADYSHWMSYWIALGIDKKTQMNYHMKPFCKDTYATEGSLEAKQTFTDKIRSAVEEIIWKSAEYCDILSEKWTGIHVSADQLKGQRNKQEDRFVAYPNGQYMNRGQSDISLLAVFDGHGGHECSQYAAAHFWEAWSDAQHHHSQDMKLDELLEKALETLDERMTVRSVRESWKGGTTAVCCAVDLNTNQIAFAWLGDSPGYIMSNLEFRKFTTEHSPSDPEECRRVEEVGGQIFVIGGELRVNGVLNLTRALGDVPGRPMISNKPDTLLKTIEPADYLVLLACDGISDVFNTSDLYNLVQAFVNEYDVEDYHELARYICNQAVSAGSADNVTVVIGFLRPPEDVWRVMKTDSDDEESELEEEDDNE"
        },
        "name": "fem-2"
      }
    ],
  }
]
// The sequence file can be directly converted to CGView JSON
const cgvJSON = seqFile.toCGViewJSON();
// Or passed to the builder
const builder = new CGParse.CGViewBuilder(seqFile);
const cgvJSON = builder.toJSON();

Feature Files (GFF3, BED, GTF)

import * as CGParse from 'cgparse';

const gff3Text = `##gff-version 3
chr1	.	gene	1000	2000	.	+	.	ID=gene1;Name=myGene`;

const featureFile = new CGParse.FeatureFile(gff3Text);

// Summary
featureFile.summary;
// {
//   inputFormat: "gff3",
//   featureCount: 1,
//   status: "success"
// }

// Array of parsed features as JSON
featureFile.records;

Records Output

[
  {
    "contig": "chr1",
    "source": ".",
    "type": "gene",
    "start": 1000,
    "stop": 2000,
    "score": ".",
    "strand": "+",
    "phase": ".",
    "attributes": {
      "ID": "gene1",
      "Name": "myGene"
    },
    "qualifiers": {},
    "valid": true,
    "name": "myGene"
  }
]
// The feature file can be directly converted to CGView features array
const cgvFeatures = featureFile.toCGViewFeaturesJSON()
// Or passed to the builder
const builder = new CGParse.FeatureBuilder(featureFile);
const featuresJSON = builder.toJSON();

Logger

The main classes (CGViewBuilder, SequenceFile, FeatureFile, and FeatureBuilder) contain a custom Logger with levels, icons, timestamps, and history. The logger can be access via the logger property on any instance.

The Logger can also be used on its own:

const logger = new CGParse.Logger({
  logToConsole: true,
  showTimestamps: true,
  showIcons: true,
  maxLogCount: undefined  // No limit
});

logger.info('Processing started');     // ℹ️ Processing started
logger.warn('Invalid feature found');  // ⚠️ Invalid feature found  
logger.error('Parse failed');          // 🛑 Parse failed

console.log(logger.count);            // Total messages logged
console.log(logger.history());        // Full log history as a string

Live Test Page

🔗 Live Demo & Test Page

The test page lets you upload or choose example files, view intermediate JSON, final CGView JSON, rendered maps, log output, and open results in Proksee.

Development

# Install dependencies
yarn install

# Run tests
yarn test

# Build for distribution
yarn build

Resources