npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2026 – Pkg Stats / Ryan Hefner

fornac

v1.1.8

Published

An RNA secondary structure display component

Readme

FornaContainer

In many situations, the user interaction is superfluous and the desired goal is to simply display a secondary structure on a web page. This is a common scenario in, for example, servers that predict a secondary structure. The output, a dot-bracket string can simply be added to a FornaContainer object to display.

Trivial Example

Below is an example of a simple web page which uses a FornaContainer to show a simple RNA molecule:

blah blah

The code for creating this web page is rather straightforward. After importing some necessary javascript files, we create a container using new FornaContainer("#rna_ss", {'applyForce': false}), passing in #rna_ss as the id of the div which will hold the container and then populate it with a structure and sequence using container.addRNA:

<!DOCTYPE html>
<meta charset="utf-8">

This is an RNA container.
<div id='rna_ss'> </div>
This after the RNA container.

    <link rel='stylesheet' type='text/css' href='styles/fornac.css' />
    <script type='text/javascript' src='scripts/fornac.js'></script>
    <script type='text/javascript'>
        var container = new FornaContainer("#rna_ss", {'applyForce': false});

        var options = {'structure': '((..((....)).(((....))).))',
                        'sequence': 'CGCUUCAUAUAAUCCUAAUGACCUAU'
        };

        container.addRNA(options.structure, options);
    </script>

Cofolded sequences

Display two cofolded sequences using the format of RNAcofold:

Cofolded sequences

    var container = new fornac.FornaContainer("#cofold_ss",
            {'applyForce': false, 'allowPanningAndZooming': true, 'initialSize':[500,300]});
                                                     
    var options = {'structure': '..((((...))))...((...((...((..&............))...))...))..',
        'sequence': 'ACGAUCAGAGAUCAGAGCAUACGACAGCAG&ACGAAAAAAAGAGCAUACGACAGCAG'
    };                                                                                     
    container.addRNA(options.structure, options);
    container.setSize(); 

Options

The FornaContainer supports a number of options to allow users to customize how the RNA will be presented.

applyForce

Indicate whether the force-directed layout will be applied to the displayed molecule. Enabling this option allows users to change the layout of the molecule by selecting and dragging the individual nucleotide nodes

allowPanningAndZooming [default=true]

Allow users to zoom in and pan the display. If this is enabled then pressing the 'c' key on the keyboard will center the view.

circularizeExternal [default=true]

This only makes sense in connection with the applyForce argument. If it's true, the external loops will be arranged in a nice circle. If false, they will be allowed to flop around as the force layout dictates:

labelInterval [default=10]

Change how often nucleotide numbers are labelled with their number.

Implementation

Each RNA molecule is represented as a JSON file which encodes all of the information necessary to display it. The example shows a trivial and slightly modified example. nodeType can be either nucleotide or label or middle, the latter of which is used only as a placeholder for maintaining an aesthetically pleasing layout.

The links can be any of basepair (representing a basepair between two nucleotides), backbone (backbone bond between adjacent nodes), pseudoknot (pseudoknot, extracted from the specified structure using maximum matching algorithm), extra (extra links specified by the user), label_link (links between nucleotides and their nucleotide number labels), fake (invisible links for maintaining the layout), and fake_fake (invisible links for maintaining the layout).

This structure is initially created in rnagraph.js starting from a sequence and dotbracket string.

{
  "nodes": 
    [ {
      "name": "A",
      "num": 1,
      "radius": 5,
      "rna": null,
      "nodeType": "nucleotide",
      "structName": "empty",
      "elemType": "e",
      "uid": "44edb966-aca9-4058-a6bc-784a34959329",
      "linked": false,
      "prevNode": null,
      "nextNode": null,
      "x": 100,
      "px": 100,
      "y": 100,
      "py": 100
    },
    ...
    ],
  "links": 
    [ {
      "source": null,
      "target": null,
      "linkType": "basepair",
      "value": 1,
      "uid": "6664a569-5af1-4d86-8ada-d1c00da72a899f87a224-52a0-4ede-a29c-04fddc09e4c4"
      },
      ...
    ]
}

Development

First:

npm install
bower install

To debug:

gulp serve

To build:

gulp build

The output will be placed in the dist directory. To use fornac in a web page, simply include dist/scripts/fornac.js in your web page.