npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2026 – Pkg Stats / Ryan Hefner

genbank-parser

v3.0.0

Published

Parse genbank files

Readme

genbank-parser

NPM version build status npm download

This work was based on TeselaGen/ve-sequence-parsers.

Parse genbank files.

Installation

npm install genbank-parser

Usage

import { readFileSync } from 'node:fs';

import { genbankToJson } from 'genbank-parser';

const genbank = readFileSync('./genbank.gb', 'utf-8');
const result = genbankToJson(genbank);

Parsed fields

The parser tries to parse all fields described by the genbank documentation.

Additional properties are added:

At the sequence level:

  • name: locus name

At the feature level:

  • name: extracted from several possible feature notes. Default is /label

Example

Input genbank

LOCUS       Z78533                   740 bp    DNA     linear   PLN 30-NOV-2006
DEFINITION  C.irapeanum 5.8S rRNA gene and ITS1 and ITS2 DNA.
ACCESSION   Z78533
VERSION     Z78533.1  GI:2765658
KEYWORDS    5.8S ribosomal RNA; 5.8S rRNA gene; internal transcribed spacer;
            ITS1; ITS2.
SOURCE      Cypripedium irapeanum
  ORGANISM  Cypripedium irapeanum
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; Liliopsida; Asparagales; Orchidaceae;
            Cypripedioideae; Cypripedium.
REFERENCE   1
  AUTHORS   Cox,A.V., Pridgeon,A.M., Albert,V.A. and Chase,M.W.
  TITLE     Phylogenetics of the slipper orchids (Cypripedioideae:
            Orchidaceae): nuclear rDNA ITS sequences
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 740)
  AUTHORS   Cox,A.V.
  TITLE     Direct Submission
  JOURNAL   Submitted (19-AUG-1996) Cox A.V., Royal Botanic Gardens, Kew,
            Richmond, Surrey TW9 3AB, UK
FEATURES             Location/Qualifiers
     source          1..740
                     /organism="Cypripedium irapeanum"
                     /mol_type="genomic DNA"
                     /db_xref="taxon:49711"
     misc_feature    1..380
                     /note="internal transcribed spacer 1"
     gene            381..550
                     /gene="5.8S rRNA"
     rRNA            381..550
                     /gene="5.8S rRNA"
                     /product="5.8S ribosomal RNA"
     misc_feature    551..740
                     /note="internal transcribed spacer 2"
ORIGIN
        1 cgtaacaagg tttccgtagg tgaacctgcg gaaggatcat tgatgagacc gtggaataaa
       61 cgatcgagtg aatccggagg accggtgtac tcagctcacc gggggcattg ctcccgtggt
      121 gaccctgatt tgttgttggg ccgcctcggg agcgtccatg gcgggtttga acctctagcc
      181 cggcgcagtt tgggcgccaa gccatatgaa agcatcaccg gcgaatggca ttgtcttccc
      241 caaaacccgg agcggcggcg tgctgtcgcg tgcccaatga attttgatga ctctcgcaaa
      301 cgggaatctt ggctctttgc atcggatgga aggacgcagc gaaatgcgat aagtggtgtg
      361 aattgcaaga tcccgtgaac catcgagtct tttgaacgca agttgcgccc gaggccatca
      421 ggctaagggc acgcctgctt gggcgtcgcg cttcgtctct ctcctgccaa tgcttgcccg
      481 gcatacagcc aggccggcgt ggtgcggatg tgaaagattg gccccttgtg cctaggtgcg
      541 gcgggtccaa gagctggtgt tttgatggcc cggaacccgg caagaggtgg acggatgctg
      601 gcagcagctg ccgtgcgaat cccccatgtt gtcgtgcttg tcggacaggc aggagaaccc
      661 ttccgaaccc caatggaggg cggttgaccg ccattcggat gtgaccccag gtcaggcggg
      721 ggcacccgct gagtttacgc
//

Parsed output

[
  {
    features: [
      {
        notes: {
          organism: ['Cypripedium irapeanum'],
          mol_type: ['genomic DNA'],
          db_xref: ['taxon:49711'],
        },
        type: 'source',
        strand: 1,
        start: 1,
        end: 740,
        name: 'Cypripedium irapeanum',
      },
      {
        notes: { note: ['internal transcribed spacer 1'] },
        type: 'misc_feature',
        strand: 1,
        start: 1,
        end: 380,
        name: 'internal transcribed spacer 1',
      },
      {
        notes: { gene: ['5.8S rRNA'] },
        type: 'gene',
        strand: 1,
        start: 381,
        end: 550,
        name: '5.8S rRNA',
      },
      {
        notes: { gene: ['5.8S rRNA'], product: ['5.8S ribosomal RNA'] },
        type: 'rRNA',
        strand: 1,
        start: 381,
        end: 550,
        name: '5.8S rRNA',
      },
      {
        notes: { note: ['internal transcribed spacer 2'] },
        type: 'misc_feature',
        strand: 1,
        start: 551,
        end: 740,
        name: 'internal transcribed spacer 2',
      },
    ],
    name: 'Z78533',
    sequence:
      'cgtaacaaggtttccgtaggtgaacctgcggaaggatcattgatgagaccgtggaataaacgatcgagtgaatccggaggaccggtgtactcagctcaccgggggcattgctcccgtggtgaccctgatttgttgttgggccgcctcgggagcgtccatggcgggtttgaacctctagcccggcgcagtttgggcgccaagccatatgaaagcatcaccggcgaatggcattgtcttccccaaaacccggagcggcggcgtgctgtcgcgtgcccaatgaattttgatgactctcgcaaacgggaatcttggctctttgcatcggatggaaggacgcagcgaaatgcgataagtggtgtgaattgcaagatcccgtgaaccatcgagtcttttgaacgcaagttgcgcccgaggccatcaggctaagggcacgcctgcttgggcgtcgcgcttcgtctctctcctgccaatgcttgcccggcatacagccaggccggcgtggtgcggatgtgaaagattggccccttgtgcctaggtgcggcgggtccaagagctggtgttttgatggcccggaacccggcaagaggtggacggatgctggcagcagctgccgtgcgaatcccccatgttgtcgtgcttgtcggacaggcaggagaacccttccgaaccccaatggagggcggttgaccgccattcggatgtgaccccaggtcaggcgggggcacccgctgagtttacgc',
    circular: false,
    moleculeType: 'DNA',
    genbankDivision: 'PLN',
    date: '2006-11-30T12:00:00.000Z',
    size: 740,
    definition: 'C.irapeanum 5.8S rRNA gene and ITS1 and ITS2 DNA.',
    accession: 'Z78533',
    version: 'Z78533.1  GI:2765658',
    keywords:
      '5.8S ribosomal RNA; 5.8S rRNA gene; internal transcribed spacer; ITS1; ITS2.',
    source: 'Cypripedium irapeanum',
    organism:
      'Cypripedium irapeanum Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; Liliopsida; Asparagales; Orchidaceae; Cypripedioideae; Cypripedium.',
    references: [
      {
        description: '1',
        authors: 'Cox,A.V., Pridgeon,A.M., Albert,V.A. and Chase,M.W.',
        title:
          'Phylogenetics of the slipper orchids (Cypripedioideae: Orchidaceae): nuclear rDNA ITS sequences',
        journal: 'Unpublished',
      },
      {
        description: '2  (bases 1 to 740)',
        authors: 'Cox,A.V.',
        title: 'Direct Submission',
        journal:
          'Submitted (19-AUG-1996) Cox A.V., Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, UK',
      },
    ],
  },
];

License

MIT