npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2026 – Pkg Stats / Ryan Hefner

react-sequence-viewer

v0.2.3

Published

A React wrapper around the BioJS sequence-viewer component

Downloads

85

Readme

react-sequence-viewer

Description

A React wrapper around the BioJS sequence-viewer component.

Installation

npm install --save react-sequence-viewer

Dependencies

The following are dependencies required by the sequence-viewer module that is wrapped by this React component.

  • jQuery
  • Bootstrap CSS

You can either include these into your HTML page or add them to your own application build (see usage below).

<script src="https://ajax.googleapis.com/ajax/libs/jquery/3.1.1/jquery.min.js"></script>
<link rel="stylesheet" type="text/css" href="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.7/css/bootstrap.min.css"></link>

Usage

The following code renders a sequence-viewer component in the HTML element with an ID of 'sequence-viewer1'.

ES6

import React from 'react';
import ReactDOM from 'react-dom';

// Either uncomment these lines or pull
// in jQuery and Bootstrap into the HTML page of your application.
// The below requires that jQuery/Bootstrap be installed as a dependency
// in your package.json file.
//import jquery from 'jquery';
//window.jQuery = jquery;

//import 'bootstrap/dist/css/bootstrap.min.css';

import ReactSequenceViewer from 'react-sequence-viewer';

const mySeq = 'CAGTCGATCGTAGCTAGCTAGCTGATCGATGC';

ReactDOM.render(
  <ReactSequenceViewer sequence={mySeq} />,
  document.getElementById('#sequence-viewer1')
);
import React from 'react';
import ReactDOM from 'react-dom';

// Either uncomment these lines or pull
// in jQuery and Bootstrap into the HTML page of your application.
// The below requires that jQuery/Bootstrap be installed as a dependency
// in your package.json file.
//import jquery from 'jquery';
//window.jQuery = jquery;

//import 'bootstrap/dist/css/bootstrap.min.css';

import ReactSequenceViewer from 'react-sequence-viewer';

const mySeq = 'CAGTCGATCGTAGCTAGCTAGCTGATCGATGC';
const options = {
  badge: true,
  search: false,
  showLineNumbers: true,
  title: "my sequence",
  toolbar: false,
};

ReactDOM.render(
  <ReactSequenceViewer sequence={mySeq} {...options} />,
  document.getElementById('#sequence-viewer1')
);

Properties / Options

Please see the Sequence Viewer documentation for more details on the options below.

| Name | Description | Type | Required | Comment | |:-----|:------------|------|----------|:--------| | className | HTML class name to apply to the Sequence Viewer div container | String | No | | | coverage | Advanced sequence hightlighting | Array[Objects] | No | Not compatible with selection | | id | The ID to use for the Sequence Viewer container element | String | No | | | legend | Adds a legend to the sequence | Array[Objects] | No | | | onMouseSelection | Event handler for sequence selection with the mouse | function | No | | | onSubpartSelected | Event handler for sequence selected via the search box | function | No | | | selection | A region to highlight | Array | No | Not compatible with coverage | | sequence | The sequence to render. | String | Yes | |