npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2026 – Pkg Stats / Ryan Hefner

synthetic

v1.1.10

Published

An Open Source Programming Language for Genetic Engineering

Downloads

635

Readme

Synthetic

Synthetic is an open-source JavaScript framework designed for genetic engineering. Write genetic constructs using a clean DSL, resolve iGEM BioBrick parts and PDB proteins automatically, and generate optimized DNA sequences — all from Javascript.

✨ Features

  • 📦 Available as an npm package
    Easily install and integrate with your JavaScript or Node.js projects.

  • 🧬 Fully open-source — MIT licensed
    Use, modify, and distribute freely under the permissive MIT license.

  • 🧭 Follows standard iGEM notations
    Compatible with iGEM BioBrick part IDs (e.g. BBa_C0040) and plasmid backbone names (e.g. pSB1C3).

  • 🧪 Built-in codon usage optimization
    Automatically optimize DNA/amino-acid sequences for any target organism using the Kazusa Codon Usage Database.

  • 🔗 Seamless integration with iGEM and the Protein Data Bank (PDB)
    Fetch and resolve genetic parts and protein structure sequences effortlessly at compile time.

  • 🧠 Supports combinatorial design
    Describe multiple variants of a genetic construct in a single expression and compile all combinations at once.


📦 Installation

npm install synthetic

🚀 Quick Start

require("synthetic");

// Simple genetic construct: promoter → RBS → CDS → terminator
compile(
  promoter("BBa_J23100") +
  rbs("BBa_B0034") +
  cds("atgaaagcaattttcgtactg") +
  terminator("BBa_B0015")
).then(variants => {
  console.log(variants); // Array of compiled DNA sequences
});

📖 API Reference

compile(construct, [onDrawPlasmid])

Compiles a construct string into an array of DNA sequences. Returns a Promise<string[]>.

  • construct — A string built by concatenating part helper calls (see Part Helpers below).
  • onDrawPlasmid (optional) — A callback invoked for each compiled variant: (plasmidId, featureTypes, variantParts) => void.

Each element in the resolved array is a fully assembled, codon-optimized DNA sequence string.

const variants = await compile(
  promoter("BBa_J23100") + rbs("BBa_B0034") + cds("atgaaa") + terminator("BBa_B0015")
);
// variants[0] → "ATGAAAGCA..."

Part Helpers

All part helpers accept either a single string or an array of strings. Using an array enables combinatorial design — every combination across all array positions is compiled as a separate variant.

| Helper | iGEM Part Type | Description | |---|---|---| | promoter(seq) | Promoter | Drives transcription | | rbs(seq) | RBS | Ribosome binding site | | cds(seq) | CDS | Protein-coding sequence | | terminator(seq) | Terminator | Ends transcription | | proteinDomain(seq) | Protein Domain | Functional protein region | | translationalUnit(seq) | Translational Unit | Full expression cassette | | dna(seq) | DNA | Raw DNA sequence | | composite(seq) | Composite | Multi-part composite device | | proteinGenerator(seq) | Protein Generator | RBS + CDS + terminator combination | | restrictionSite(seq) | Restriction Site | Restriction enzyme recognition sequence | | reporter(seq) | Reporter | Reporter gene (e.g. GFP) | | inverter(seq) | Inverter | NOT-gate logic element | | receiver(seq) | Receiver | Signal receiver part | | sender(seq) | Sender | Signal sender part | | measurement(seq) | Measurement | Measurement/characterization part | | primerBindingSite(seq) | Primer Binding Site | PCR primer binding region |

Each seq argument can be:

  • A raw DNA sequence string (e.g. "atgaaacgt")
  • An amino-acid sequence string (uppercase single-letter codes, e.g. "MKAIF") — optimized to codons at compile time
  • An iGEM BioBrick ID (e.g. "BBa_C0040") — fetched from the iGEM Parts Registry
  • A PDB entry ID (4-character, e.g. "7BKX") — protein sequence fetched from RCSB PDB and codon-optimized
  • An array of any of the above for combinatorial variants

Codon Usage Optimization

The default codon table targets Escherichia coli O157:H7. Use the functions below to switch organisms.

searchCodonUsageTable(query)

Searches the Kazusa database for organisms by name. Returns Promise<Array<{id, name, type, division, geneCount}>>.

const results = await searchCodonUsageTable("Saccharomyces");
// [{ id: "4932", name: "Saccharomyces cerevisiae [gbpln]", division: "Plant", geneCount: 10359 }, ...]

getCodonUsageTable(id)

Fetches the codon usage table for a Kazusa organism ID. Returns a parsed table object (cached after first call).

const table = await getCodonUsageTable("4932"); // S. cerevisiae
// table.dnaTripletFrequencies → Array of 64 codon entries
// table.aminoAcidFrequencies  → Most-frequent codon per amino acid

setCodonUsageTable(id)

Fetches the codon usage table for the given organism ID and sets it as the globally active table used by compile.

await setCodonUsageTable("4932"); // Switch to S. cerevisiae

optimizeSequence(aaSequence)

Converts a single-letter amino-acid string into a codon-optimized DNA string using the currently active codon usage table.

const dna = optimizeSequence("MKAIF");
// → "atgaaagcaattttt"

🧪 Examples

Simple construct with raw sequences

require("synthetic");

compile(
  promoter("tataaa") +
  rbs("aggagg") +
  cds("atgaaagcaattttcgtactg") +
  terminator("tgcatggc")
).then(variants => console.log(variants));

Using iGEM BioBrick parts

Parts matching the pattern BBa_* or pSB* are automatically fetched from the iGEM Parts Registry.

require("synthetic");

compile(
  promoter("BBa_J23100") +
  rbs("BBa_B0034") +
  cds("BBa_E0040") +   // GFP
  terminator("BBa_B0015")
).then(variants => console.log(variants));

Using a PDB protein sequence

Parts matching a 4-character alphanumeric ID (e.g. 7BKX) are fetched from RCSB PDB and codon-optimized.

require("synthetic");

compile(
  promoter("BBa_J23100") +
  rbs("BBa_B0034") +
  cds("7BKX") +          // Fetches protein from PDB and optimizes codons
  terminator("BBa_B0015")
).then(variants => console.log(variants));

Using a GenBank accession

Parts matching common GenBank / RefSeq nucleotide accession formats (e.g. JX123456, NC_000913.3) are fetched from NCBI GenBank.

require("synthetic");

compile(
  promoter("BBa_J23100") +
  rbs("BBa_B0034") +
  cds("NC_000913.3") +   // Fetches nucleotide sequence from GenBank
  terminator("BBa_B0015")
).then(variants => console.log(variants));

Combinatorial design

Pass an array to any part helper to generate all variant combinations automatically.

require("synthetic");

// Generates 2×2 = 4 variants: all combinations of 2 promoters × 2 RBS sequences
compile(
  promoter(["BBa_J23100", "BBa_J23119"]) +
  rbs(["BBa_B0034", "BBa_B0032"]) +
  cds("BBa_E0040") +
  terminator("BBa_B0015")
).then(variants => {
  console.log(`Generated ${variants.length} variants`);
  variants.forEach((seq, i) => console.log(`Variant ${i + 1}: ${seq.slice(0, 40)}...`));
});

Switching codon usage tables

require("synthetic");

// Use S. cerevisiae codon frequencies instead of the default E. coli
await setCodonUsageTable("4932");

compile(
  promoter("tataaa") +
  rbs("aggagg") +
  cds("MKAIFVL") +    // Amino acids → optimized for yeast
  terminator("tgcatggc")
).then(variants => console.log(variants));

Plasmid visualization callback

require("synthetic");

compile(
  promoter("BBa_J23100") + rbs("BBa_B0034") + cds("BBa_E0040") + terminator("BBa_B0015"),
  (plasmidId, featureTypes, parts) => {
    console.log(`Plasmid ${plasmidId} features:`, featureTypes);
    console.log(`Parts:`, parts);
  }
);

🔖 Naming Conventions

iGEM BioBrick IDs

  • Format: BBa_XXXXXXX (e.g. BBa_J23100, BBa_E0040)
  • Plasmid backbones: pSBXXX (e.g. pSB1C3)
  • Reference: iGEM Part Names

PDB Entry IDs

  • Format: 4-character alphanumeric (e.g. 7BKX, 1ABC)
  • Reference: RCSB PDB

GenBank / RefSeq accession IDs

  • Formats include examples like JX123456, AB123456, AB12345678, ABCD12345678, NC_000913.3
  • Reference: NCBI accession formats

Raw DNA sequences

  • Only characters a, c, g, t (case-insensitive) are treated as raw DNA.

Amino-acid sequences

  • Uppercase single-letter codes (e.g. MKAIFVL) are codon-optimized using the active codon usage table.

📄 License

MIT © Eliad Moshe