npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2024 – Pkg Stats / Ryan Hefner

tn93

v0.3.5

Published

A Javascript implementation of the TN93 genetic distance algorithm

Downloads

17

Readme

TN93.js

This is a simple Javascript program to quantify the difference between two DNA sequences. The algorithm is commonly called TN93, after its authors (Tamura and Nei) and the year in which they published it (1993). The Original Source is here.

This repository was created for use by CDC programs to collaborate on public health surveillance related projects in support of the CDC Surveillance Strategy. Github is not hosted by the CDC, but is used by CDC and its partners to share information and collaborate on software.

Getting it

In Browser:

<script src="path/to/tn93.js"></script>

In Node:

const tn93 = require('tn93');

Using it

var sequence1 = 'CCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGACTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGGAAATTGAATTGGGCAAGTCAGATTTACCCAGGGATTAAAGTAAGGCAATTATGTAAACTCCTTAGAGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGAGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAATATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAACCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTGCCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACCTTC';
var sequence2 = 'CCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAGGAAAAAATAAAAGCATTGGTAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCCAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAGTTAGGAATACCACATCCTGCAGGGTTAAAAAAGAAGAAATCAGTAACAGTATTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGAGTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAAACACCACGGATTAGATATCAGTACAATGTGCTTCCACAAGGGTGGAAAGGATCACCAGCAATATTCCAAAGTAGTATGACAAAAATCTTAGAGCCTTTTAAAAAACAAAATCCAGAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGATTTAGAAATAGGGCAGCATAGAATAAAAATAGAGGAACTGAGAGAACATCTGTTAAAGTGGGGGTTTACCACACCGGACAAGAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTGAATTGGGCAAGTCAGATTTATGCAGGGATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAGTACAACTAACAAAAGAAGCAGAGCTAGAACTGGCAGAAAATAGGGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATACCAAATTTATCAAGAGCCATTTAAAAACCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTACAAAAAGTAGCCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTACCCATACAAAAAGAAACATGGGAGGCATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTAAAATTGTGGTACCAGTTAGAAAAAGAACCCATAATAGGAGCAGAAACTTTC';
var distance  = tn93(sequence1, sequence2);
console.log(distance); //0.04515599702813972

Credits

This borrows significantly from the C implementation of the same algorithm, libtn93, though it's been manually recoded in Javascript, rather than transpiled.

Public Domain

This repository constitutes a work of the United States Government and is not subject to domestic copyright protection under 17 USC § 105. This repository is in the public domain within the United States, and copyright and related rights in the work worldwide are waived through the CC0 1.0 Universal public domain dedication. All contributions to this repository will be released under the CC0 dedication. By submitting a pull request you are agreeing to comply with this waiver of copyright interest.

License

The repository utilizes code licensed under the terms of the Apache Software License and therefore is licensed under ASL v2 or later.

This source code in this repository is free: you can redistribute it and/or modify it under the terms of the Apache Software License version 2, or (at your option) any later version.

This source code in this repository is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the Apache Software License for more details.

You should have received a copy of the Apache Software License along with this program. If not, see http://www.apache.org/licenses/LICENSE-2.0.html

The source code forked from other open source projects will inherit its license.

Privacy

This repository contains only non-sensitive, publicly available data and information. All material and community participation is covered by the Surveillance Platform Disclaimer and Code of Conduct. For more information about CDC's privacy policy, please visit http://www.cdc.gov/privacy.html.

Contributing

Anyone is encouraged to contribute to the repository by forking and submitting a pull request. (If you are new to GitHub, you might start with a basic tutorial.) By contributing to this project, you grant a world-wide, royalty-free, perpetual, irrevocable, non-exclusive, transferable license to all users under the terms of the Apache Software License v2 or later.

All comments, messages, pull requests, and other submissions received through CDC including this GitHub page are subject to the Presidential Records Act and may be archived. Learn more at http://www.cdc.gov/other/privacy.html.

Records

This repository is not a source of government records, but is a copy to increase collaboration and collaborative potential. All government records will be published through the CDC web site.

Notices

Please refer to CDC's Template Repository for more information about contributing to this repository, public domain notices and disclaimers, and code of conduct.