ToRNAdoFold

Fast RNA secondary-structure prediction by minimum free energy using the Turner 2004 nearest-neighbour model (Mathews et al., 2004), with dangling ends scored on both sides of every helix.

SIMD-accelerated and header-only C++11 library. Runs on the command line, as a library, or in the browser.

• Exact Turner 2004 nearest-neighbour model in exact integer arithmetic.
• Fast SIMD-accelerated folding (ARM NEON, x86 SSE2/AVX2/AVX-512, WebAssembly SIMD) with OpenMP batch mode.
• Portable header-only C++11, no dependencies; embed via CMake.
• In the browser interactive WebAssembly folding and visualization.

Command line

make
# prints sequence, structure, and MFE
echo GGGGAAAACCCC | ./tornadofold
# FASTA, or one sequence per line
./tornadofold < sequences.fa

Fold a batch in parallel:

make tornadofold_omp
OMP_NUM_THREADS=8 ./tornadofold_omp < sequences.fa

As a library

add_subdirectory(path/to/lib EXCLUDE_FROM_ALL)
target_link_libraries(myapp PRIVATE tornadofold::tornadofold)

#include "tornadofold.h"

tornadofold::TornadoFold f;
// minimum free energy, in 0.01 kcal/mol
int mfe = f.fold("GGGGAAAACCCC");
// dot-bracket
std::string structure = f.traceback(mfe);

In the browser

npm install tornadofold-wasm

import { fold } from "tornadofold-wasm";

// structure is dot-bracket, one character per base; mfe is in kcal/mol
const { structure, mfe } = await fold("GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCC");

T is read as U, whitespace is removed and any other character is treated as unknown (N), therefore positions in structure line up with the input.

To run the demo page locally:

make wasm
python3 -m http.server -d web
# open http://localhost:8000

Paste a sequence to fold and view its structure, or upload a FASTA to fold in parallel across web workers.

Benchmark

ArchiveII (3966 reference structures; Sloma & Mathews, 2016) against RNAfold (Lorenz et al., 2011) 2.7.2 -d2, on an NVIDIA DGX Spark (20-core ARM CPU):

| tool | 1 thread | 20 threads | sensitivity | PPV | F1 | F1 (macro) | |-------------|---------:|-----------:|------------:|------:|------:|-----------:| | ToRNAdoFold | 41.5 s | 3.3 s | 0.577 | 0.506 | 0.539 | 0.577 | | RNAfold | 112.3 s | 9.4 s | 0.576 | 0.506 | 0.539 | 0.577 |