npm package discovery and stats viewer.

Discover Tips

  • General search

    [free text search, go nuts!]

  • Package details

    pkg:[package-name]

  • User packages

    @[username]

Sponsor

Optimize Toolset

I’ve always been into building performant and accessible sites, but lately I’ve been taking it extremely seriously. So much so that I’ve been building a tool to help me optimize and monitor the sites that I build to make sure that I’m making an attempt to offer the best experience to those who visit them. If you’re into performant, accessible and SEO friendly sites, you might like it too! You can check it out at Optimize Toolset.

About

Hi, 👋, I’m Ryan Hefner  and I built this site for me, and you! The goal of this site was to provide an easy way for me to check the stats on my npm packages, both for prioritizing issues and updates, and to give me a little kick in the pants to keep up on stuff.

As I was building it, I realized that I was actually using the tool to build the tool, and figured I might as well put this out there and hopefully others will find it to be a fast and useful way to search and browse npm packages as I have.

If you’re interested in other things I’m working on, follow me on Twitter or check out the open source projects I’ve been publishing on GitHub.

I am also working on a Twitter bot for this site to tweet the most popular, newest, random packages from npm. Please follow that account now and it will start sending out packages soon–ish.

Open Software & Tools

This site wouldn’t be possible without the immense generosity and tireless efforts from the people who make contributions to the world and share their work via open source initiatives. Thank you 🙏

© 2025 – Pkg Stats / Ryan Hefner

vibing

v0.1.0

Published

Experimental RNA structure drawing in typescript

Downloads

6

Vulnerabilities

Powered byPowered by Snyk
  • 0High
  • 0Medium
  • 0Low

Links

Maintainers

vedtopkarvedtopkar

Keywords

Readme

VIBING

Varna Implemented as a Browser Interface for Nucleic acid Graphing

Ved's attempt at using Typescript to write a pure Javascript RNA secondary structure drawing app. Play around with it here: https://vedtopkar.github.io/vibing

Demo

ts-rna-draw-demo

Use the GUI

Using the following inputs:

AAAAAGGGGGAAGGGGAAACCCAAGGGGAAACCCACCCCCAAAAAAAAAAGGGGGGAAAAAAACCACCCAAAAA
.....(((((..(((....)))..(((....))).)))))..........(((((........)).))).....

We get: ts-rna-draw-example

Use as CLI utility

You can install this package with npm. First, install node.js. On MacOS you can just do a quick brew install node.

Once you have node (and thus npm) installed, you can install this package as a global CLI utility by running:

npm install -g vibing

Local Development

Clone:

git clone https://github.com/vedtopkar/vibing.git

Install npm module dependencies:

cd vibing && yarn install

For development, start the parcel server with yarn:

yarn watch

Your page will reload every time you hit save on a modified .ts or .html file.

Dependencies

Feature TODOs

  • ~~Implement pan mouse functionality~~
  • Figure out robust vertical text centering for nucleotides
  • ~~Implement interactive flipping stems around baseline~~
  • ~~Scale up terminal loop radius for large-sequence loops~~
  • ~~Abstract away global variables for drawing config~~
  • ~~Split up drawing scripts for each element type~~
  • ~~Update stem drawing for arbitrary angles~~
  • ~~Implement drawing bulges~~
  • ~~Implement drawing internal loops~~
  • ~~Implement drawing multi-loops~~
  • ~~Implement zoom mouse functionality~~
  • ~~Implement interactive stem moving at bulges~~
  • ~~Implement interactive stem moving at internal loops~~
  • ~~Implement interactive stem moving at multi-loops~~